How To Convert A Set Of DNA Sequences Into Protein Sequences Using Python Programming?

I am using python to create a program that converts a set of DNA sequences into amino acid (protein) sequences. I then need to find a specific subsequence, and count the number of

Solution 1:

You should read about Biopython. It comes with handy functions and classes related to Biology and Bioinformatics.

It has a function that does what you are looking for: Bio.Seq.translate

Here you have code example:

>>> coding_dna = "GTGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG"
>>> translate(coding_dna)
'VAIVMGR*KGAR*'
>>> translate(coding_dna, stop_symbol="@")
'VAIVMGR@KGAR@'
>>> translate(coding_dna, to_stop=True)
'VAIVMGR'

Solution 2:

Using your codon chart and also accounting for stop codon. Here is a python one-liner:

print([gencode[i] for i in re.findall(r"[A-Z]{3}", re.sub("AUG(.+)","", input("DNA: ").translate(str().maketrans({"A":"U","T":"A","C":"G","G":"C"}))))])