Skip to content Skip to sidebar Skip to footer
Showing posts with the label Biopython
Biopython Pdb: Calculate Distance Between An Atom And A Point

Biopython Pdb: Calculate Distance Between An Atom And A Point

Post a Comment
Using a typical pdb file, I am able to calculate the distance between two atoms in a structure usin… Read more Biopython Pdb: Calculate Distance Between An Atom And A Point
Muscle Alignment In Python

Muscle Alignment In Python

Post a Comment
I have a problem with printing my output from muscle aligning in python. My code is: from Bio.Align… Read more Muscle Alignment In Python
How To Select Only Certain Substrings

How To Select Only Certain Substrings

Post a Comment
from a string say dna = 'ATAGGGATAGGGAGAGAGCGATCGAGCTAG' i got substring say dna.format = &… Read more How To Select Only Certain Substrings
Calculating The Distance Between Atomic Coordinates

Calculating The Distance Between Atomic Coordinates

Post a Comment
I have a text file as shown below ATOM 920 CA GLN A 203 39.292 -13.354 17.416 1.00 55.7… Read more Calculating The Distance Between Atomic Coordinates
How To Convert A Set Of DNA Sequences Into Protein Sequences Using Python Programming?

How To Convert A Set Of DNA Sequences Into Protein Sequences Using Python Programming?

Post a Comment
I am using python to create a program that converts a set of DNA sequences into amino acid (protein… Read more How To Convert A Set Of DNA Sequences Into Protein Sequences Using Python Programming?